Journal:

Article Title: Bcl-2 antiapoptotic protein mediates verotoxin II-induced cell death: possible association between Bcl-2 and tissue failure by E. coli O157:H7

doi:

Figure Lengend Snippet: VTII-Bcl-2 complex formation. (A) VTII, but not VTI, contains the pentameric sequence from the Bcl-2 BH1 domain. Shown are the schematic model, sequence alignment, and protein identities and similarities of human Bcl-2, VTI and VTII. The dotted line indicates the region of splicing variants. (B,C). VTII, but not VTI, interacts with Bcl-2. Expression of Bcl-2 in V (-) and B10 (+) cells was detected with immunoblotting (IB). B10 (B) and/or V (B,C) cell extracts were separated by SDS-PAGE, and far-western blotting (FW) was performed with biotinylated peptides (NWGRL and NWGRI in B) or VTs (VTI and VTII in C). Interacted protein was detected with avidin-HRP and ECL. Bars on the left show positions of protein markers 46, 30, 20, and 14 kDa, from top to bottom. (D) VTII interacts with Bcl-2 through the NWGRI sequence. Far-western blotting analysis was performed with biotinylated VTII and B10 cell extracts in the presence of NWGRI (0, 1, 5, and 10 nm). (E) Coimmunoprecipitation analysis. V (-) or B10 (+) cells were treated with VTII, and then immunoprecipitates with antibodies for Bcl-2 (Bcl-2 IPs) or VTII (VTII IPs) were separated on SDS-PAGE, and immunoblotting analysis with VTII antibody was performed (VTII WB).

Article Snippet: After washing with Tween-PBS, the membranes were incubated with a 1000-fold diluted biotinylated second antibody, washed with Tween-PBS, and then incubated with avidin-HRP (Vector Laboratories, Burlingame, CA) at room temperature for 1 hour.

Techniques: Sequencing, Expressing, Western Blot, SDS Page, Far Western Blot, Avidin-Biotin Assay

Journal: Nature Communications

Article Title: FERARI and cargo adaptors coordinate cargo flow through sorting endosomes

doi: 10.1038/s41467-022-32377-y

Figure Lengend Snippet: a Rab11 vesicles perform kiss-and-run dependent on FERARI. Movie stills showing kiss-and-run of endogenously GFP-tagged Rab11 vesicles (arrow) in ctr KO ( n = 41) and vipas39-KO ( n = 25) HeLa cells (see also Supplementary Movie ). Scale bar: 2 µm. b Rab11 vesicles dock on SNX1 networks with residence times in distinct intervals. Groups of vesicles with similar residence times appear as peaks (see also Supplementary Fig. for single-vesicle graph, mock : n = 41, vipas39-KO : n = 25). This pattern is abolished in vipas39 -KO cells (see Supplementary Fig. for ehd1-KO and rab11fip5-KO additional data). One-way multiple comparison ANOVA test P -values: mock-vipas39-KO P = 1.98E-09, mock-ehd1-KO P = 1.6E-10, mock-rab11fip5-KO P = 1.58E-09. c List of FERARI genes in C. elegans and H. sapiens . The human nomenclature is used throughout the manuscript. The model organism is indicated by a human or worm icon next to the data. d Movie stills showing kiss-and-run of Rab5 vesicles (arrow) in wild-type worms ( n = 53). Scale bar: 2 µm. e Movie stills showing kiss-and-run of Rab5 vesicles (arrow) in ehd1(RNAi) worms ( n = 33) (see also Supplementary Movie ). Scale bar: 2 µm. f Rab5 vesicles dock on SNX1 networks with residence times in distinct intervals (see also Supplementary Fig. for single-vesicle graph, n = 53). This pattern is abolished in ehd1 ( n = 33) and fip5 ( n = 35) knock-downs (see Supplementary Fig. for single-vesicle plots). One-way multiple comparison ANOVA test P -values: mock-ehd1 P = 4.63E-05, mock-fip5 P = 3.83E-05. g Residence times intervals in Rab5 vesicles docking to mCherry-EHD1 compartments ( wild-type from f as comparison, n = 63) (see Supplementary Fig. ). Unpaired two-tailed t -test: P = 0.8467. h Rab5 exhibits kiss-and-run behavior in HeLa cells stably expressing mApple-Rab5 and transiently expressing GFP-SNX1. Movie stills show representative vesicles for ctr KO ( n = 41) and vipas39- KO ( n = 23) cells (arrow) (see also Supplementary Movie ). Scale bars: 2 µm. i Binning of vesicles from (h) reveals distinct intervals of residence times for Rab5 vesicles ( mock : n = 41, vipas39-KO : n = 23). This pattern is abolished in vipas39-KO cells (see Supplementary Fig. for single-vesicle plots). Unpaired two-tailed t -test: P = 0.000118.

Article Snippet: GFP-VPS16 and TfR-Halo were a kind gift from Paul Luzio and Matthew Kennedy, respectively. mCherry-SNX1 was created by PCR amplifying mCherry from a mCherry-Rab11 construct (Plasmid #55124) and ligation (Roche rapid ligation kit) into the NotI/PmeI sites of the SNX1 vector (Origene; RG201844) from which Turbo-GFP was deleted by restriction digestion (NotI/PmeI). mCherry was cloned into EGFP-RAB10 vector (Addgene; 49472) after deleting EGFP. mCherry was synthesized from a mCherry Rab11 plasmid (Addgene; 55124).

Techniques: Comparison, Two Tailed Test, Stable Transfection, Expressing

Journal: Nature Communications

Article Title: FERARI and cargo adaptors coordinate cargo flow through sorting endosomes

doi: 10.1038/s41467-022-32377-y

Figure Lengend Snippet: a Movie stills for GFP-Rab5-positive vesicles (arrows) fusing, then docking on mCherry-SNX1 compartment (kiss-and-run for 18s) and finally fusing with a larger sorting endosome (with GFP-Rab5 and mCherry-SNX1 domains) ( n = 53, kiss-and-run, n = 19 fusing). Scale bar: 2 µm. b Cargo adaptor ESCRT-0 subunit Hrs moves with vesicles that perform kiss-and-run on SNX1 compartments ( n = 67) (movie stills from Supplementary Movie , arrow points to Hrs-positive vesicle). Scale bar: 2 µm. c Kiss-and-run behavior of Hrs vesicles depends on FERARI subunit EHD1 ( n = 30) (movie stills from Supplementary Movie , arrow points to Hrs-positive vesicle). Scale bar: 2 µm. d Hrs vesicles dock on SNX1 networks with residence times in distinct intervals. Groups of vesicles with similar residence times appear as peaks (see also Supplementary Fig. for single-vesicle graph, mock : n = 67, ehd1-KO : n = 30). Unpaired two-tailed t -test: P = 2.03E-06.

Article Snippet: GFP-VPS16 and TfR-Halo were a kind gift from Paul Luzio and Matthew Kennedy, respectively. mCherry-SNX1 was created by PCR amplifying mCherry from a mCherry-Rab11 construct (Plasmid #55124) and ligation (Roche rapid ligation kit) into the NotI/PmeI sites of the SNX1 vector (Origene; RG201844) from which Turbo-GFP was deleted by restriction digestion (NotI/PmeI). mCherry was cloned into EGFP-RAB10 vector (Addgene; 49472) after deleting EGFP. mCherry was synthesized from a mCherry Rab11 plasmid (Addgene; 55124).

Techniques: Two Tailed Test

Journal: Nature Communications

Article Title: FERARI and cargo adaptors coordinate cargo flow through sorting endosomes

doi: 10.1038/s41467-022-32377-y

Figure Lengend Snippet: a GFP-Rab10 compartments docking onto mCherry-SNX1 networks in worm intestine (see also 3D projection, Supplementary Movie ). Regions of co-localization are indicated by arrows. Quantification of co-localization by Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. M1 denotes the overlap between SNX1 and Rab10, and M2 between Rab10 and SNX1. One-way multiple comparison ANOVA test P -values: M1 SNX1-Rab10 vs. SNX1-DHS-3 P = 1.94E-08, M1 SNX1-Rab10 vs. SNX1-MANS P = 9.62E-09, M2 SNX1-Rab10 vs. SNX1-DHS-3 P = 4.37E-13, M2 SNX1-Rab10 vs. SNX1-MANS P = 4.43E-13. Scale bar: 2 µm. b Genetic interaction between FERARI subunits and Rab10. rab10(ok1494) causes accumulation of SNX1 compartments. RNAi of vps45 and vipas39 but not vps33B (CHEVI) show additional enlargement of SNX1 (arrowheads). n = 20 worms from 3 experiments (for quantification see Supplementary Fig. ). Scale bar: 10 µm. c Western blot of CRISPR–Cas9-mediated KO of Rab10 in HeLa cells ( n = 3 independent experiments). d Size of the endogenous SNX1 structure is enlarged in rab10 KO cells. SNX1 was detected by immunofluorescence. Violin plot showing the enlarged volume of the SNX1 structure in ctr and rab10 KO cells (volume of >14,700 particles was measured from each group from three independent experiments, median indicated by the red line). Unpaired two-tailed t -test: P = 1.46E-17. Scale bars 10 µm. e Movie stills for Rab10 vesicles (arrow) showing kiss-and-run in ehd1(RNAi) ( n = 40) and wild-type worms ( n = 51) (Supplementary Movie ). “N”: nucleus with high mCh-SNX1 signal. Scale bar: 2 µm. f Rab10 vesicles show residence times with quantal increases ( n = 51). This behavior is abolished in ehd1 ( n = 40) and fip5 ( n = 36) knock-downs (Supplementary Fig. for single-vesicle plots). One-way multiple comparison ANOVA test P -values: mock-ehd1 P = 7.23E-08, mock-fip5 P = 4.29E-10. g Kiss-and-run of Rab10 on sorting compartments is conserved in metazoans. Residence times of Rab10 vesicles exhibit characteristic intervals abolished in vipas39- KO cells (see Supplementary Fig. for single-vesicle plots). Unpaired two-tailed t -test: P = 0.000128. h Movie stills of mCherry-tagged Rab10 vesicles (arrow) showing kiss-and-run on SNX1 (GFP-tagged) compartment in ctr KO and vipas39- KO HeLa cells ( n = 3 independent experiments, mock : n = 53, vipas39-KO : n = 22 vesicles) (see Supplementary Movie ). Scale bar: 2 µm.

Article Snippet: GFP-VPS16 and TfR-Halo were a kind gift from Paul Luzio and Matthew Kennedy, respectively. mCherry-SNX1 was created by PCR amplifying mCherry from a mCherry-Rab11 construct (Plasmid #55124) and ligation (Roche rapid ligation kit) into the NotI/PmeI sites of the SNX1 vector (Origene; RG201844) from which Turbo-GFP was deleted by restriction digestion (NotI/PmeI). mCherry was cloned into EGFP-RAB10 vector (Addgene; 49472) after deleting EGFP. mCherry was synthesized from a mCherry Rab11 plasmid (Addgene; 55124).

Techniques: Comparison, Western Blot, CRISPR, Immunofluorescence, Two Tailed Test

Journal: Nature Communications

Article Title: FERARI and cargo adaptors coordinate cargo flow through sorting endosomes

doi: 10.1038/s41467-022-32377-y

Figure Lengend Snippet: a Knock-downs of syx16, vamp7, vti1 , and syx3 cause FERARI-like phenotypes as seen in vps45(RNAi) (long RFP-Rab10 tubules indicated by large arrowheads), while syx6 and syx7 do not (short tubules indicated by small arrowheads) ( n = 20 animals per condition). b Tubule length was quantified for n = 10 different tubules in n = 6 animals examined over three independent RNAi experiments (total n = 60). Data are presented as mean values +/– SD. One-way multiple comparison ANOVA test P -values: all indicated differences are smaller than P = 1E-15. Scale bar: 10 µm. c Knock-down of syx3 causes enlargement of Rab11 compartments, similar to previously published FERARI knock-downs ( n = 20 animals per condition). Scale bar: 10 µm. d GFP-SYX3 localizes to mCherry-SNX1, mCherry-EHD1, and RFP-Rab10 structures (Supplementary Movie with 3D projections) ( n = 10 animals). Scale bar: 2 µm. e Mander’s coefficients are shown for n = 10 worms. Data are presented as mean values +/– SD. One-way multiple comparison ANOVA test P -values: M1 SYX3-SNX1 vs. SYX3-EHD1 P = 1.0901E-09, M1 SYX3-SNX1 vs. SYX3-Rab10 P = 0.00116, M1 SYX3-EHD1 vs. SYX3-Rab10 P = 0.00424, M2 SYX3-SNX1 vs. SYX3-EHD1 P = 7.43E-12, M2 SYX3-SNX1 vs. SYX3-Rab10 P = 0.000351, M2 SYX3-EHD1 vs. SYX3-Rab10 P = 0.000149.

Article Snippet: GFP-VPS16 and TfR-Halo were a kind gift from Paul Luzio and Matthew Kennedy, respectively. mCherry-SNX1 was created by PCR amplifying mCherry from a mCherry-Rab11 construct (Plasmid #55124) and ligation (Roche rapid ligation kit) into the NotI/PmeI sites of the SNX1 vector (Origene; RG201844) from which Turbo-GFP was deleted by restriction digestion (NotI/PmeI). mCherry was cloned into EGFP-RAB10 vector (Addgene; 49472) after deleting EGFP. mCherry was synthesized from a mCherry Rab11 plasmid (Addgene; 55124).

Techniques: Comparison, Knockdown

Journal: Nature Communications

Article Title: FERARI and cargo adaptors coordinate cargo flow through sorting endosomes

doi: 10.1038/s41467-022-32377-y

Figure Lengend Snippet: a Fluorescence intensities of single vesicles were measured during the docking phase of kiss-and-run events. Linear regressions were calculated for Rab5 vesicles ( n = 20), normalized and plotted together (single-vesicle graphs are shown in Supplementary Fig. ). b Rab11 vesicles were analyzed as described in a . c Cargo containing vesicles (hTfR-GFP) displayed either increasing or decreasing fluorescence intensities (see also Supplementary Fig. for single-vesicle plots). d Analysis of Glut1-GFP-positive vesicles showed a similar result as for hTfR-GFP in c . e Cargo transfer from Rab5 vesicles into SNX1 compartments. Movie stills (from Supplementary Movie ) showing halo-TfR (red) in docking Rab5 vesicles (blue) that is moving into a SNX1 tubule (green). Co-localizing pixels (shown in white and with arrows) were determined with the “co-localization finder” plugin in ImageJ. The halo-TfR channel is also shown for comparison. Two vesicles serially dock at the same site on the SNX1 tubule (shown by arrowheads 1 and 2). ( n = 3 experiments with n = 20 cells each). Scale bar: 2 µm. f Rab11 vesicles can take up halo-TfR cargo from SNX1 tubules. Rab11 vesicle (blue, arrowhead) docking on to a SNX1 tubule (green) taking up TfR (red). Co-localizing pixels (arrows pointing at white pixels) were determined by the “co-localization finder” plugin of ImageJ. Single-channel images for halo-Tfr are also shown for comparison. Stills are from Supplementary Movie . ( n = 3 experiments with n = 20 cells each). Scale bar: 2 µm. g Residence times for hTfR-GFP vesicles decrease when cargo amount is reduced. Moving average for residence times is shown for wild-type (no knock-down, n = 55) and gfp(RNAi) ( n = 46) (see Supplementary Fig. for alternative graphs). Graphs with individual vesicle data are shown in Supplementary Fig. . Unpaired two-tailed t -test: P = 0.000655. h Residence times for Glut1-GFP vesicles decrease when cargo amount is reduced. Residence times are plotted as in a for wild-type (no RNAi, n = 56) and gfp(RNAi) ( n = 54). (see Supplementary Fig. for alternative graphs). Unpaired two-tailed t -test: P = 0.00268. i , j Bar graphs with binning for each peak in g and h , showing the number of vesicles in each peak.

Article Snippet: GFP-VPS16 and TfR-Halo were a kind gift from Paul Luzio and Matthew Kennedy, respectively. mCherry-SNX1 was created by PCR amplifying mCherry from a mCherry-Rab11 construct (Plasmid #55124) and ligation (Roche rapid ligation kit) into the NotI/PmeI sites of the SNX1 vector (Origene; RG201844) from which Turbo-GFP was deleted by restriction digestion (NotI/PmeI). mCherry was cloned into EGFP-RAB10 vector (Addgene; 49472) after deleting EGFP. mCherry was synthesized from a mCherry Rab11 plasmid (Addgene; 55124).

Techniques: Fluorescence, Comparison, Knockdown, Two Tailed Test

Journal: Nature Communications

Article Title: FERARI and cargo adaptors coordinate cargo flow through sorting endosomes

doi: 10.1038/s41467-022-32377-y

Figure Lengend Snippet: a snx6(RNAi) leads to increased co-localization of GFP-Rab5 vesicles with mCherry-SNX1 networks (see Supplementary Movie ). Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. Unpaired two-tailed t -test: M1 P = 2.61E-05, M2 P = 2.06E-05. Scale bar: 2 µm. b snx6(RNAi) leads to increased co-localization of GFP-Rab11 vesicles with mCherry-SNX1 networks (see Supplementary Movie ). Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. Unpaired two-tailed t -test: M1 P = 0.000113, M2 P = 9.501E-05. Scale bar: 2 µm. c snx-6(RNAi) increases GFP-Rab10 compartment co-localization with mCh-SNX1 in C. elegans (Supplementary Movie ). Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. Unpaired two-tailed t -test: M1 P = 3.96E-06, M2 P = 1.16E-06. Scale bar: 2 µm. d snx6(RNAi) drastically increases the residence times of vesicles. The Rab5 wild-type vesicles are plotted as a dashed line for comparison (see Supplementary Fig. for single-vesicle plots). Please note the elongated x -axis to accommodate vesicles with very long residence times ( n = 62 for Rab5, n = 57 for Rab11). One-way multiple comparison ANOVA test P -values: Rab5 wt vs. Rab5 snx6 P = 7.76E-07, Rab5 wt vs. Rab11 snx6 P = 1.051E-06. e Rab5 vesicles from snx6(RNAi) worms are increased in size ( wt : n = 828, snx-6 : n = 1459) (see Supplementary Fig. for single worms). Unpaired two-tailed t -test P = 1.45E-11. f Rab11 vesicles from snx6(RNAi) worms appear smaller ( wt : n = 774, snx6 : n = 995) (see Supplementary Fig. for single worms). Unpaired two-tailed t -test P = 1E-15. g Co-localization of Rab5 and SNX1 is increased in snx5 + 6 KO cells. HeLa cells were co-transfected with GFP-SNX1 and mApple-Rab5. Representative images from live-cell imaging of ctr and snx5 + 6 KO are shown. Rab5 and SNX1-positive structures are enlarged in snx5 + 6 KO cells ( n = 3 independent experiments, see quantification of volume of Rab5 structures below). Unpaired two-tailed t -test P = 1.615E-249. Scale bars 10 µm. h Knock-down of snx-6 increases RFP-Rab10 compartment co-localization with GFP-EHD1 in C. elegans . Mander’s coefficients ( n = 10). Data are presented as mean values +/– SD. Unpaired two-tailed t -test: M1 P = 0.000275, M2 P = 1.896E-05. Scale bar: 2 µm.

Article Snippet: GFP-VPS16 and TfR-Halo were a kind gift from Paul Luzio and Matthew Kennedy, respectively. mCherry-SNX1 was created by PCR amplifying mCherry from a mCherry-Rab11 construct (Plasmid #55124) and ligation (Roche rapid ligation kit) into the NotI/PmeI sites of the SNX1 vector (Origene; RG201844) from which Turbo-GFP was deleted by restriction digestion (NotI/PmeI). mCherry was cloned into EGFP-RAB10 vector (Addgene; 49472) after deleting EGFP. mCherry was synthesized from a mCherry Rab11 plasmid (Addgene; 55124).

Techniques: Two Tailed Test, Comparison, Transfection, Live Cell Imaging, Knockdown

Journal: Nature Communications

Article Title: FERARI and cargo adaptors coordinate cargo flow through sorting endosomes

doi: 10.1038/s41467-022-32377-y

Figure Lengend Snippet: a Co-localization between GFP-Rab11 and endogenous SNX1 is reduced in snx5 + 6 double knock out cells. Antibodies against GFP and SNX1 were used to detect Rab11 and SNX1 by immunofluorescence, respectively. Scale bars 10 µm; 5x magnified. Pearson’s coefficient from n = 65 and n = 71 cells from ctr KO and snx5 + 6 KO cells, respectively. Data are presented as single data points with median and min to max whiskers. Unpaired two-tailed t -test P = 2.5316E-07. b Size of the GFP-Rab11-positive structures is increased in snx5 + 6 KO cells in comparison with the ctr KO cells ( n = 3 independent experiments) Scale bars 10 µm; magnification 5x. c Volume of the GFP-Rab11-positive particles in both ctr and KO cells were determined (volume of >15,000 particles were measured from each group from three independent experiments, median is shown by the red line). Unpaired two-tailed t -test P = 3.05E-73. d CI-MPR trafficking is impaired in snx 5 + 6 KO cells. CI-MPR (red) is mostly localized in TGN (green) area in ctr KO cells and is dispersed in snx 5 + 6 KO cells ( n = 3 independent experiments, n = 150 cells per condition). Pearson’s coefficient measurements are shown on the right. Unpaired two-tailed t -test P = 1.97E-51. Scale bars 10 µm. e CI-MPR localization remain unchanged in vipas39 KO cells ( n = 3 independent experiments, n = 150 cells per condition). Scale bars 10 µm; magnification 5x. Co-localization was quantified by Pearsons’s coefficients. Unpaired two-tailed t -test P = 0.0536. f Immunoprecipitation data showing that endogenous SNX6 (left panel), but not SNX5 (right panel), binds to FERARI members Rabenosyn-5 and VIPAS39 in HEK-293 cells ( n = 3 independent experiments). g C. elegans SNX6 interacts with RABS-5 (but not with other FERARI subunits) in Y2H assays. Quantification is shown in Table ( n = 3 growth experiments with n = 6 independent yeast colonies each).

Article Snippet: GFP-VPS16 and TfR-Halo were a kind gift from Paul Luzio and Matthew Kennedy, respectively. mCherry-SNX1 was created by PCR amplifying mCherry from a mCherry-Rab11 construct (Plasmid #55124) and ligation (Roche rapid ligation kit) into the NotI/PmeI sites of the SNX1 vector (Origene; RG201844) from which Turbo-GFP was deleted by restriction digestion (NotI/PmeI). mCherry was cloned into EGFP-RAB10 vector (Addgene; 49472) after deleting EGFP. mCherry was synthesized from a mCherry Rab11 plasmid (Addgene; 55124).

Techniques: Knock-Out, Immunofluorescence, Two Tailed Test, Comparison, Immunoprecipitation

Journal: Nature Communications

Article Title: FERARI and cargo adaptors coordinate cargo flow through sorting endosomes

doi: 10.1038/s41467-022-32377-y

Figure Lengend Snippet: a AP1 cargo adaptor moves with vesicles performing kiss-and-run on SNX1 compartments. Movie still (from Supplementary Movie ) showing docking of vesicle 1 (arrowhead), followed by a second vesicle (arrowhead 2) that docks at the same site and then moves on to dock to an additional SNX1 tubule ( n = 61). Docking of vesicles is indicated by asterisks. Scale bar: 2 µm. b AP1 vesicles show residence times with 4 s intervals (as seen with other vesicles docking in a FERARI-dependent manner). Residence times of n = 61 vesicles were measured and plotted in bins (see Supplementary Fig. for single-vesicles graph). c Adaptor knock-downs affect cargo traffic through SNX1 compartments. RNAi of snx17, snx27, apm1 or aps1 cause enlargement of SNX1 compartments (black arrows: large empty round compartments, arrowheads: large filled compartments (see also Supplementary Fig. )). hTfR-GFP was found in enlarged compartments as well (white arrows). Single-channel images are also shown. hTfR accumulations were absent in snx27(RNAi) worms. Some of the hTfR accumulations co-localized with enlarged SNX1 structures (asterisks). Experiments were repeated n = 3 times with n = 20 worms analyzed. Scale bar: 10 µm. d Quantification of enlarged hTfR-GFP compartments in adaptor knock-down worms ( n = 6). One-way multiple comparison ANOVA test P -values: all differences are smaller than P = 1E-15, ns P = 0.967. e Cargo flow hypothesis, showing 3 subsequent steps of cargo sorting. First, Rab5 vesicles unload non-bound recycling cargo and enrich ESCRT-bound cargo for transport into late endosomes/lysosomes. Second, low affinity binding to SNX6 organizes cargo inside the SNX1 tubular network. Third, higher affinity adaptors in Rab11 vesicles are used to bind cargo for final transport to destination (e.g., plasma membrane). Subsequent steps of kiss-and-run ensure enrichment of wanted cargoes (and loss of unwanted ones), allowing for a “proofreading” of cargo content despite low binding affinities to adaptors. The process of vesicle biogenesis by formation of tubules, followed by cargo enrichment with adaptor complexes and pinching-off of vesicles is a crucial first step in the sorting process and is also depicted.

Article Snippet: GFP-VPS16 and TfR-Halo were a kind gift from Paul Luzio and Matthew Kennedy, respectively. mCherry-SNX1 was created by PCR amplifying mCherry from a mCherry-Rab11 construct (Plasmid #55124) and ligation (Roche rapid ligation kit) into the NotI/PmeI sites of the SNX1 vector (Origene; RG201844) from which Turbo-GFP was deleted by restriction digestion (NotI/PmeI). mCherry was cloned into EGFP-RAB10 vector (Addgene; 49472) after deleting EGFP. mCherry was synthesized from a mCherry Rab11 plasmid (Addgene; 55124).

Techniques: Knockdown, Comparison, Binding Assay, Clinical Proteomics, Membrane

Journal:

Article Title: Proteomic Identification of Non-Gal Antibody Targets After Pig-to-Primate Cardiac Xenotransplantation

doi: 10.1111/j.1399-3089.2008.00480.x

Figure Lengend Snippet: Specificity of induced anti-pig IgG. A. Flow cytometry measuring the binding of IgG purified from Group A necropsy serum to GT-KO PAECs. Upper left number in each panel indicates the source of the IgG and the number in the upper right is the mean fluorescence intensity. Specific binding is the dark line. Background binding (filled histogram) was determined using only the FITC conjugated secondary antibody. 1; IgG from a pool of naive baboon serum. 2 – 4; IgG purified from necropsy serum of recipients that received no treatment for antibody (2), TPC (3), or TPC and Rituximab (4). B. Western blot analysis of purified Group A IgG binding to GT-KO PAEC membrane antigens. Numbers of each lane indicate the source of IgG and correspond to FACS panels in A. C. Flow cytometry analysis of IgG binding to GT-KO PAECs using antibody recovered from rejected Group B xenografts. Xenograft rejected on day 52 (solid) and day 79 (dashed) are presented in the top panel and xenograft rejected on day 21 (solid) and day 27 (dashed) in the bottom panel. Background binding (filled) was determined using the FITC secondary antibody only. D. Western blot detection of recovered IgG binding to GT-KO PAEC membrane antigens. Duration of graft survival is indicated for each lane.

Article Snippet: Isolation of GT-KO plasma fibronectin and ELISA analysis Porcine fibronectin was purified from GT-KO plasma using a Gelatin-Sepharose 4B (GE Healthcare, Piscataway, NJ) column and further purified by size exclusion chromatography using a Superdex 200 16/60 column (GE Healthcare).

Techniques: Flow Cytometry, Binding Assay, Purification, Fluorescence, Western Blot, Membrane

Journal: BMC Neuroscience

Article Title: GT1b-induced neurotoxicity is mediated by the Akt/GSK-3/tau signaling pathway but not caspase-3 in mesencephalic dopaminergic neurons

doi: 10.1186/1471-2202-11-74

Figure Lengend Snippet: GT1b increases the activity GSK-3β by dephosphorylation in neuron-enriched mesencephalic cultures . (A) Western blot analysis showing dephosphorylation of GSK-3β in GT1b-treated cultures. Cell lysates were analyzed by Western blot analysis with phospho-GSK-3β (Ser9) antibody at indicated time points. After membrane stripping, blots were reprobed with total GSK-3β. (B) The histogram shows quantification of phospho-GSK-3β levels. The values represent the mean ± SEM of four separate experiments; *P < 0.001, significant from non-treated control cultures (0 h) (ANOVA and Student-Newman-Keuls analyses). (C) TH-ip neurons were counted in cultures treated with 20 μg/ml GT1b for 24 h in the absence or presence of 20 μM L803-mt, GSK-3β specific inhibitor. The values represent the mean ± SEM of triplicate cultures in three to five separate samples. *P < 0.001, significant from non-treated control cultures; # P < 0.01, significant from GT1b-treated cultures (ANOVA and Student-Newman-Keuls analyses).

Article Snippet: Materials were purchased from the following companies: mouse anti-tyrosine hydroxylase (TH; Pel-Freez, Rogers, AR, USA), rabbit anti-tyrosine hydroxylase (TH; Pel-Freez), mouse anti-neuron specific nuclear protein (NeuN; Chemicon, Temecula, CA, USA), rabbit anti-GABA and mouse anti-actin (Sigma, St. Louis, MO, USA), rabbit anti-phospho-Akt (Ser473), rabbit anti-phospho-Akt (Thr308), rabbit anti-phospho-GSK-3β (Ser9), rabbit anti-Akt and rabbit anti-GSK-3β (Cell Signaling Technology, MA, USA), mouse anti-AT8 (phospho-tau (Ser202), INOGENETICS, Gent, Belgium), biotinylated secondary antibody and ABC kit (Vector Laboratory, Burlington, CA, USA), FITC-conjugated anti-mouse IgG and Texas Red-conjugated anti-rabbit IgG (Molecular Probes, OR, USA).

Techniques: Activity Assay, De-Phosphorylation Assay, Western Blot, Membrane, Stripping Membranes, Control

Journal: BMC Neuroscience

Article Title: GT1b-induced neurotoxicity is mediated by the Akt/GSK-3/tau signaling pathway but not caspase-3 in mesencephalic dopaminergic neurons

doi: 10.1186/1471-2202-11-74

Figure Lengend Snippet: Phosphorylation of tau is increased by GT1b treatment in mesencephalic cultures . Double-immunostaining with AT8 (Ser202; green)) for phospho-tau and TH (red) for DA neurons in mesencephalic cultures treated with vehicle (A) or 20 μg/ml GT1b (B) for 8 h. (D-I) Double-immunostaining showed Tau hyperphosphorylation in the GT1b-injected SN. SN tissues were prepared 72 h after PBS (D-F) or GT1b (60 μg/3 μl, G-I) injection, processed for immunostaining with TH antibody alone (C), double-immunostaining with AT8 (D, G, green) and TH (E, H, red) antibody, and then both images were merged (F, I). Scale bar, 10 μm in A-C, 200 μm in F and 50 μm G-I. SNpc, substantia nigra pars compacta; SNr, substantia nigra reticulata; VTA, ventral tegmental area. (J,K) Cell lysates were analyzed by Western blot analysis with AT8 (Ser202) antibody at indicated time points. After membrane stripping, blots were then reprobed with actin antibody. The histogram shows quantitation of tau phosphorylation. (L.M) Tau phosphorylation is reversed by L803-mt, GSK-3 inhibitor in GT1b-treated mesencephalic cultures. The histogram shows quantitation of tau phosphorylation. The values represent the mean ± SEM of triplicate cultures in three to five separate samples. *P < 0.001, **P < 0.01 significant from non-treated cultures; # P < 0.01, significant from GT1b-treated cultures (ANOVA and Student-Newman-Keuls analyses). C, control; G, GT1b; L, L803mt.

Article Snippet: Materials were purchased from the following companies: mouse anti-tyrosine hydroxylase (TH; Pel-Freez, Rogers, AR, USA), rabbit anti-tyrosine hydroxylase (TH; Pel-Freez), mouse anti-neuron specific nuclear protein (NeuN; Chemicon, Temecula, CA, USA), rabbit anti-GABA and mouse anti-actin (Sigma, St. Louis, MO, USA), rabbit anti-phospho-Akt (Ser473), rabbit anti-phospho-Akt (Thr308), rabbit anti-phospho-GSK-3β (Ser9), rabbit anti-Akt and rabbit anti-GSK-3β (Cell Signaling Technology, MA, USA), mouse anti-AT8 (phospho-tau (Ser202), INOGENETICS, Gent, Belgium), biotinylated secondary antibody and ABC kit (Vector Laboratory, Burlington, CA, USA), FITC-conjugated anti-mouse IgG and Texas Red-conjugated anti-rabbit IgG (Molecular Probes, OR, USA).

Techniques: Phospho-proteomics, Double Immunostaining, Injection, Immunostaining, Western Blot, Membrane, Stripping Membranes, Quantitation Assay, Control

Journal: BMC Neuroscience

Article Title: GT1b-induced neurotoxicity is mediated by the Akt/GSK-3/tau signaling pathway but not caspase-3 in mesencephalic dopaminergic neurons

doi: 10.1186/1471-2202-11-74

Figure Lengend Snippet: Schematic drawing of Akt/GSK-3β/tau signaling . Akt is activated in response to ILK or PI3 Kinase signaling, and subsequent activation of Akt. Akt is activated in response to ILK or PI3 kinase signaling, and subsequent activation of Akt. Activated Akt phosphorylates GSK-3β at Ser 9, leading to GSK-3β inactivation. Akt inactivation by GT1b induces dephosphorylation of GSK-3β, leading to GSK-3β activation. GSK-3β activation results in aberrant tau phosphorylation, axon instability, and neuronal death. Although we did not provide direct evidence of whether GT1b neuroxocicity is mediated by ILK or PI3K signaling or both, participation of GT1b in inhibition of Akt upstream signals, such as ILK or PI3K, is predicted.

Article Snippet: Materials were purchased from the following companies: mouse anti-tyrosine hydroxylase (TH; Pel-Freez, Rogers, AR, USA), rabbit anti-tyrosine hydroxylase (TH; Pel-Freez), mouse anti-neuron specific nuclear protein (NeuN; Chemicon, Temecula, CA, USA), rabbit anti-GABA and mouse anti-actin (Sigma, St. Louis, MO, USA), rabbit anti-phospho-Akt (Ser473), rabbit anti-phospho-Akt (Thr308), rabbit anti-phospho-GSK-3β (Ser9), rabbit anti-Akt and rabbit anti-GSK-3β (Cell Signaling Technology, MA, USA), mouse anti-AT8 (phospho-tau (Ser202), INOGENETICS, Gent, Belgium), biotinylated secondary antibody and ABC kit (Vector Laboratory, Burlington, CA, USA), FITC-conjugated anti-mouse IgG and Texas Red-conjugated anti-rabbit IgG (Molecular Probes, OR, USA).

Techniques: Activation Assay, De-Phosphorylation Assay, Phospho-proteomics, Inhibition

Journal: Advanced Science

Article Title: The Non‐Coding Regulatory Variant rs2863002 at chr11p11.2 Increases Neuroblastoma Risk by Affecting HSD17B12 Expression and Lipid Metabolism

doi: 10.1002/advs.202415181

Figure Lengend Snippet: The rs2863002 SNP alters the binding site for the transcription factor GATA3. A) The graph shows the combined results of the TF motifs enrichment analysis (‐Log10P, y‐axis) and the FABIAN scores related to the alteration of the TF binding motifs due to rs2863002 (FABIAN, x‐axis). Each dot represents a TF binding motif with color and size related to the score obtained with the FABIAN prediction tool, while the dotted lines represent the threshold values chosen to classify TF motif disruption (red) or gain (blue). B) ChIP‐seq tracks for GATA3 TF obtained from neuroblastoma cell lines. The image shows rs2863002 at chr11:43 714 768 (hg19/GRCh37) in correspondence with in‐house generated (dark blue) and publicly available (light blue) GATA3 ChIP‐seq data from neuroblastoma cell lines deposited in the GEO database. Data ranges are shown on the left, while neuroblastoma cell lines are reported on the right. C) Chromatin fold enrichment obtained in GATA3 ChIP qPCR experiments carried out in SH‐SY5Y and NMB cells. We report the chromatin fold enrichment obtained for a negative (chr5:24682868–24682979) and a positive (chr2:15982438–15982518) control region for GATA3 binding, respectively in blue and violet, and for the genomic region of rs2863002 in pink. Enrichment measurements are folded on Rabbit IgG and represent the mean ±SD from three independent experiments. D) Chromatin fold enrichment obtained in GATA3 ChIP qPCR experiments carried out in SK‐N‐BE(2) wild‐type cells and relative CRISPR/cas9 edited clones (clone#1, #2, and #3). We report the chromatin fold enrichment obtained for a negative and a positive DNA control region for GATA3 binding, and for the genomic region of rs2863002, as in (B). ns not significant; * p ‐value < 0.05; ** p ‐value < 0.01; *** p ‐value < 0.001. p ‐values were calculated by t ‐test.

Article Snippet: [ ] In brief, a guide RNA (gRNA, 5′‐GATTGATTAAAAGCAACGAT‐3′) was designed using the CRISPOR Tool ( http://crispor.tefor.net/ ) and cloned into a pSpCas9(BB)‐2A‐GFP (PX458) vector expressing Cas9 (Addgene).

Techniques: Binding Assay, Disruption, ChIP-sequencing, Generated, ChIP-qPCR, Control, CRISPR, Clone Assay

Journal: Advanced Science

Article Title: The Non‐Coding Regulatory Variant rs2863002 at chr11p11.2 Increases Neuroblastoma Risk by Affecting HSD17B12 Expression and Lipid Metabolism

doi: 10.1002/advs.202415181

Figure Lengend Snippet: The rs2863002 SNP acts as an enhancer in neuroblastoma cells, positively influencing HSD17B12 expression. A) Luciferase reporter gene assays were carried out in the SH‐SY5Y, SH‐EP, and HEK293 cell lines. Luciferase activity of the constructs harboring the C and T alleles of rs2863002 was compared to a PGL3 empty control vector. The results are expressed as relative luminescence units (RLU) and the ratio between firefly/renilla luciferases provided the normalized luciferase activity for each vector. Data represent the mean ± SD of three independent experiments and p ‐values were obtained by t ‐test. B,C) Violin plots showing the median expression of HSD17B12 according to rs2863002 genotypes in adrenal gland tissue (GTEx portal) (B), and in the TARGET database of neuroblastoma patients (C). D) Hi‐C results obtained in SK‐N‐BE(2)C neuroblastoma cell line, showing the genomic region including rs2863002 on genome assembly hg19/GRCh37. The interaction matrix is centered on rs2863002 at chr11:43 714 768 and extended of 0.4 Mb up‐ and down‐stream. Genomic coverage is 500Kb and the matrix resolution is 10Kb. Red triangles represent the Topologically Associated Domains (TADs). The genomic tracks displayed from top to bottom are: the arcs track showing the interactions between rs2863002 and the up‐stream annotated bins; the normalized number of interactions; the minus Log10 of the FDR adjusted p ‐values; the NCBI RefSeq genes. A brown‐bordered rectangle highlights the HSD17B12 locus. E) Representative western blot image of HSD17B12 expression in SK‐N‐BE(2) wild‐type and CRISPR/Cas9‐edited clones. β‐Actin protein level was used as the loading control. F,G) Quantitative measurements of HSD17B12 protein (F) and mRNA (G) expression in SK‐N‐BE(2) wild‐type and CRISPR/Cas9‐edited clones. H) Correlation analysis of HSD17B12 and GATA3 expression from R2 Genomics ( GSE62564 ). R, correlation coefficient; P, p ‐value. I) Western blot images of GATA3 and HSD17B12 protein levels after 72 h of GATA3 siRNA transfection in SH‐SY5Y, NMB, and SK‐N‐BE(2)C. ns non‐significant; * p ‐value < 0.05; ** p ‐value < 0.01; *** p ‐value < 0.001. p ‐values were calculated by t ‐test.

Article Snippet: [ ] In brief, a guide RNA (gRNA, 5′‐GATTGATTAAAAGCAACGAT‐3′) was designed using the CRISPOR Tool ( http://crispor.tefor.net/ ) and cloned into a pSpCas9(BB)‐2A‐GFP (PX458) vector expressing Cas9 (Addgene).

Techniques: Expressing, Luciferase, Activity Assay, Construct, Control, Plasmid Preparation, Hi-C, Western Blot, CRISPR, Clone Assay, Transfection

Journal: Advanced Science

Article Title: The Non‐Coding Regulatory Variant rs2863002 at chr11p11.2 Increases Neuroblastoma Risk by Affecting HSD17B12 Expression and Lipid Metabolism

doi: 10.1002/advs.202415181

Figure Lengend Snippet: HSD17B12 is an oncogenic driver enhancing cell growth and invasion in neuroblastoma. A,B) HSD17B12 efficient silencing was measured by western blot (A) and qRT‐PCR (B) in SH‐SY5Y and NMB neuroblastoma cell lines 72 h post siRNA transfection. Data represent the mean ±SD from three independent experiments. C,D) Assessment of cell proliferation in SH‐SY5Y and NMB cell lines after silencing of HSD17B12 (C) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (clone#1, #2, and #3) (D). Cell viability measurements were performed using MTT assays at 0, 24, 48, and 72 h post siRNA transfection (C) or after seeding (D). Data shown are the mean ±SD from two independent MTT experiments, with six technical replicates for each experimental point. E,F) Representative images of trans‐well invasion assays performed in SH‐SY5Y and NMB cell lines after silencing of HSD17B12 (E) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (clone#1, #2, and #3) (F). G,H) Number of invasive cells as measured in SH‐SY5Y and NMB silenced cell lines (G) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (clone#1, #2, and #3) (H). Data represent the mean ±SD from two independent experiments. * p ‐value < 0.05; ** p ‐value < 0.01; *** p ‐value < 0.001. p ‐values obtained by t ‐test.

Article Snippet: [ ] In brief, a guide RNA (gRNA, 5′‐GATTGATTAAAAGCAACGAT‐3′) was designed using the CRISPOR Tool ( http://crispor.tefor.net/ ) and cloned into a pSpCas9(BB)‐2A‐GFP (PX458) vector expressing Cas9 (Addgene).

Techniques: Western Blot, Quantitative RT-PCR, Transfection, CRISPR, Clone Assay

Journal: Advanced Science

Article Title: The Non‐Coding Regulatory Variant rs2863002 at chr11p11.2 Increases Neuroblastoma Risk by Affecting HSD17B12 Expression and Lipid Metabolism

doi: 10.1002/advs.202415181

Figure Lengend Snippet: Down‐regulation of HSD17B12 alters lipid molecules affecting the fluidity of membranes and lipid droplet properties. A,B) Membrane fluidity was assessed by measuring the ratio of pyrene‐decanoic acid (PDA) excimer to monomer fluorescence in SH‐SY5Y and SK‐N‐BE(2)C cells after silencing of HSD17B12 (A) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (clone#1, #2, and #3) (B). Fluorescence was evaluated at 400 nm for monomers and 470 nm for excimers. Data represent the mean ± SD of the measurements compared with control conditions (siScrambled) in (A) and SK‐N‐BE(2) wild type in (B) each from two independent experiments performed in duplicate. C,D) Representative confocal images of neutral lipid staining by LipidTOX Green (green) in SH‐SY5Y and SK‐N‐BE(2)C cells after silencing of HSD17B12 (C) and in SK‐N‐BE(2) wild‐type cells and edited clones (D). Nuclei were counterstained with DRAQ5 (blue). Scale bar 20 µM. E,F) Quantification of lipid droplet number obtained through cell‐by‐cell measurements in SH‐SY5Y and SK‐N‐BE(2)C cells after silencing of HSD17B12 (E) and in SK‐N‐BE(2) wild‐type cells and relative CRISPR/Cas9‐edited clones (F). Data represent the mean number ± SD of lipid droplets per cell; measurements have been performed on a mean number of 100 cells per experimental condition. * p ‐value < 0.05; ** p ‐value < 0.01. p ‐values were calculated by t ‐test.

Article Snippet: [ ] In brief, a guide RNA (gRNA, 5′‐GATTGATTAAAAGCAACGAT‐3′) was designed using the CRISPOR Tool ( http://crispor.tefor.net/ ) and cloned into a pSpCas9(BB)‐2A‐GFP (PX458) vector expressing Cas9 (Addgene).

Techniques: Membrane, Fluorescence, CRISPR, Clone Assay, Control, Staining

Journal: Journal of cell science

Article Title: Control of Notch-ligand endocytosis by ligand-receptor interaction.

doi: 10.1242/jcs.073239

Figure Lengend Snippet: Fig. 2. Characterization of the signaling capacity of Jagged1WT, Jagged1Ndr, Jagged1Slm and Jagged1Htu. (A)12XCSL-luciferease reporter activity in co- cultures of Notch-expressing cells (carrying 12XCSL-luc) and cells expressing wild-type or mutated Jagged1. Bar graphs show luciferase activity (arithmetic mean) from triplicates of each co-culture. Error bars indicate s.d.; ***P<0.001. (B)Western blot analysis of lysates from stable cell lines (Flp-in HEK293 cells) expressing no Jagged1 (–), Jagged1WT, Jagged1Ndr, Jagged1Slm, and Jagged1Htu show comparable levels of Jagged1 (reprobed with -actin as loading control). (C)Cell lines expressing Jagged1WT, but not Jagged1Ndr, Jagged1Slm and Jagged1Htu, bind N1ECD-Fc-Cy3 as assessed by FACS analysis of cells exposed to N1ECD-Fc-Cy3 for 1 hour. (D)Cells expressing Jagged1WT, but not Jagged1Ndr, Jagged1Slm and Jagged1Htu, bind N1ECD-Fc-Cy3 (red), whereas all four cell lines express Jagged1 (green) at the cell surface. Scale bar: 20m. (E)Streptavidin-precipitation of cell-surface biotinylated proteins (top panel; without biotin as control, bottom panel) from HEK293 cells stably expressing Jagged1WT, Jagged1Ndr, Jagged1Slm and Jagged1Htu. Reprobing for nicastrin shows that only the mature, cell-surface-bound form, is detected in the streptavidin-precipitated material (the five lanes to the right). (F)12XCSL-luciferease reporter activity from Notch-expressing cells (carrying 12XCSL-luc) co-cultured with cells expressing wild-type Jagged1 and increasing levels of Jagged1Ndr. No dominant-negative effect by Jagged1Ndr is observed.

Article Snippet: The following primary and secondary antibodies were used in the study: rabbit antiJagged1 (Santa Cruz), goat anti-Jagged1 (Santa Cruz), rabbit anti-pan Cadherin (BD Biosciences), mouse anti-HA (Nordic Biosite and Covance), rabbit anti-GFP (Abcam), rat anti-PECAM (BD Biosciences), rabbit anti-nicastrin (Sigma), anti-mouse Alexa Fluor 488 (Molecular Probes/Invitrogen) anti-mouse Cy3 (Jackson), anti-mouse Cy5 (Jackson), anti-rabbit Alexa Fluor 488 (Molecular Probes/Invitrogen), anti-goat Alexa Fluor 488 (Molecular probes/Invitrogen), anti-goat Cy3 (Jackson) anti-human Cy3 (Jackson), anti-human Cy5 (Jackson), anti-rat HRP (Vector Laboratories), antigoat HRP (DAKO), anti-mouse HRP (DAKO), and anti-rabbit HRP (DAKO).

Techniques: Activity Assay, Expressing, Luciferase, Co-Culture Assay, Western Blot, Stable Transfection, Control, Cell Culture, Dominant Negative Mutation

Journal: Journal of cell science

Article Title: Control of Notch-ligand endocytosis by ligand-receptor interaction.

doi: 10.1242/jcs.073239

Figure Lengend Snippet: Fig. 3. Mib1 and endocytosis of Jagged1 are required for activation of, but not binding to, Notch receptors. (A,B)12XCSL-luciferease reporter activity in full-length Notch1-expressing cells co-cultured with cells transiently transfected with (A) EGFP, Jagged1+EGFP or Jagged1+EGFP-tagged DynaminII K44A as indicated or (B) control siRNA, Jagged1+control siRNA or Jagged1+siRNA specific for MIB1 as indicated. Bar graphs show luciferase activity (arithmetic mean) from triplicates of each co-culture. Luciferase activity was normalized to control cultures transfected with EGFP (A) or control siRNA (B). Error bars indicate s.d.; **P<0.01. (C)Immunocytochemistry demonstrating that cells transfected with DynaminII K44A and Jagged1 (top cell) can bind N1ECD-Fc-Cy3, whereas cells not transfected with DynaminII K44A and Jagged1 (the bottom cell) does not bind N1ECD-Fc-Cy3. As a control for block of endocytosis by DynaminII K44A, there is no transferrin uptake in the top (DynaminII K44A expressing) cell, whereas transferrin is internalized in the bottom cell. Scale bar: 10m. Immunofluorescence images were adjusted using the levels function in Photoshop. In each case, adjustments were applied to the entire image. (D)Detection of ligand-receptor interaction by flow cytometry in cells transiently transfected with empty plasmid and EGFP, Jagged1 and EGFP or DynaminII K44A and EGFP, as indicated. (E)Detection of ligand-receptor interaction by flow cytometry in cells transiently transfected with empty plasmid and control siRNA, Jagged1 and control siRNA or Jagged1 and MIB1 siRNA, as indicated. Percentages of fluorescently labeled cells (arithmetic mean) is shown (bar graphs). Error bars indicate s.d.; *P<0.05, **P<0.01.

Article Snippet: The following primary and secondary antibodies were used in the study: rabbit antiJagged1 (Santa Cruz), goat anti-Jagged1 (Santa Cruz), rabbit anti-pan Cadherin (BD Biosciences), mouse anti-HA (Nordic Biosite and Covance), rabbit anti-GFP (Abcam), rat anti-PECAM (BD Biosciences), rabbit anti-nicastrin (Sigma), anti-mouse Alexa Fluor 488 (Molecular Probes/Invitrogen) anti-mouse Cy3 (Jackson), anti-mouse Cy5 (Jackson), anti-rabbit Alexa Fluor 488 (Molecular Probes/Invitrogen), anti-goat Alexa Fluor 488 (Molecular probes/Invitrogen), anti-goat Cy3 (Jackson) anti-human Cy3 (Jackson), anti-human Cy5 (Jackson), anti-rat HRP (Vector Laboratories), antigoat HRP (DAKO), anti-mouse HRP (DAKO), and anti-rabbit HRP (DAKO).

Techniques: Activation Assay, Binding Assay, Activity Assay, Expressing, Cell Culture, Transfection, Control, Luciferase, Co-Culture Assay, Immunocytochemistry, Blocking Assay, Immunofluorescence, Flow Cytometry, Plasmid Preparation, Labeling

Journal: Journal of cell science

Article Title: Control of Notch-ligand endocytosis by ligand-receptor interaction.

doi: 10.1242/jcs.073239

Figure Lengend Snippet: Fig. 7. NECD is transendocytosed into Jagged1WT-expressing cells and transported through the endocytic degradation pathway. (A)HEK293T cells expressing full length HA-Notch1 (N-terminally tagged Notch1) were co-cultured with Jagged1WT-expressing HEK293T cells transfected with EGFP-EEA1. HA immunoreactivity was observed in EGFP-positive and Jagged1-positive vesicles indicating trans-endocytosis of Notch1 ECD into EEA1-positive vesicles in Jagged1-expressing cells. Boxed region is magnified in inset. Scale bar: 20m. (B)Jagged1WT cells exhibit high levels of trans-endocytosis of Notch1 ECD, whereas Jagged1Ndr cells exhibit low-to-no trans-endocytosis of Notch1ECD into Jagged1- and EEA1-positive vesicles (arrowheads). Scale bar: 20m. (C-E)Immunocytochemistry of cells with fluorescently labeled subcellular markers and incubated with N1ECD-Fc-Cy3. (C)Immediately after incubation, N1ECD-Fc-Cy3 (red) colocalized with the plasma-membrane marker EGFP-F. (D)At 1 hour, N1ECD-Fc-Cy3 (red) was detected in EGFP-EEA1-positive vesicles. (E)At 4 hours, N1ECD-Fc-Cy5 (green) was detected in lysosomes, as visualized by the lysosome marker Lysotracker Red (red).

Article Snippet: The following primary and secondary antibodies were used in the study: rabbit antiJagged1 (Santa Cruz), goat anti-Jagged1 (Santa Cruz), rabbit anti-pan Cadherin (BD Biosciences), mouse anti-HA (Nordic Biosite and Covance), rabbit anti-GFP (Abcam), rat anti-PECAM (BD Biosciences), rabbit anti-nicastrin (Sigma), anti-mouse Alexa Fluor 488 (Molecular Probes/Invitrogen) anti-mouse Cy3 (Jackson), anti-mouse Cy5 (Jackson), anti-rabbit Alexa Fluor 488 (Molecular Probes/Invitrogen), anti-goat Alexa Fluor 488 (Molecular probes/Invitrogen), anti-goat Cy3 (Jackson) anti-human Cy3 (Jackson), anti-human Cy5 (Jackson), anti-rat HRP (Vector Laboratories), antigoat HRP (DAKO), anti-mouse HRP (DAKO), and anti-rabbit HRP (DAKO).

Techniques: Expressing, Cell Culture, Transfection, Immunocytochemistry, Labeling, Incubation, Clinical Proteomics, Membrane, Marker